(h) Lane M: 100bp ladder, Lane 1 Amplified

(h) Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain     

      of Hindon River

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

(i) Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain     

                        of Faridabad waste water

(j) Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain     

                        of Faridabad waste water

(k) Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain     

      of Canal water

(l) Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain     

     of Canal water.

                 Molecular mechanisms underlying Plasmid-mediated quinolone Resistance genes 

       4.6.2 Distribution of genes encoding PMQR

 

   Following PCR-based detection, the qnrS, aaclb-cr genes were  identified in E.coli

(14/46) 30.43 % & K. pneumonia (12/30) 40% and aac-lb-cr in the E. coli (9/46) 19.56 % & K. pneumonia (7/30) 23.33 % strains in that order (Fig.23 & 24)

 

 

 

 

 

M    1

456 bp

1

M

   M

  1

1111

                                       

M     1

M   1

M    1

M   1

    456bp

456bp

   456bp

  456bp

                                                          

                               a                           b                          c                                            d                         

M     1

   M    1

 M     1

                

M    1

456bp

456bp

456bp

456bp

                                                   

 

                               e                         f                        g                      h

M     1

M     1

  M      1

M     1

  456bp

  456bp

 456bp

456bp

                                                                          

                               i                         j                        k                      l

Fig. 49: Amplification products observed in 1% agarose gels. (A) Representative

              amplicons for qnrS from E. coli strains  (B) Representative amplicons for

              qnrS from K. pneumonia strains.

             (a) Lane M: 100bp ladder.  Lane 1: Amplified product of E. coli strain

             (b) Lane M: 100bp ladder.  Lane-1: Amplified product of K. pneumonia strain

   (c) Lane M: 100bp ladder, Lane  1 Amplified product of E. coli strain

         of Sewage water

   (d) Lane M: 100bp ladder, Lane  1 Amplified product of K. pneumonia strain

        of Sewage water

   (e) Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain of  

        Ground water

   (f)  Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain     

         of Ground water

   (g) Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain     

         of Hindon River

   (h) Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain     

        of Hindon River

   (i) Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain     

        of Faridabad waste water

   (j) Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain     

        of Faridabad waste water

   (k) Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain     

         of Canal water

   (l) Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain     

        of Canal water

 

       482bp

M      1       2

M    1      2

482bp

              

                                                     a                                                                               b

 

    482bp

  M     1 

   M   1   2

          482bp

482bp

456bp

M

1

2

1

M

                  

                                                      c                                                                            d           

                      

482bp

M      1

M    1

482bp

              

                                                 

                                          e                                                               f

 

M      1

   M     1

482bp

    482bp

           

                                        g                                                          h

 

                      

M       1

482bp

482bp

M      1

             

                                          i                                                          j

 M      1

482bp

M     1

482bp

             

                                         k                                                          l

                      Fig. 50 : Amplification products observed in 1% agarose gels. (A) Representative

                                 amplicons for   aac lb-cr from E.coli strains (B) Representative amplicons  

                                 for aac lb-cr from K. pneumonia strains

(a) Lane M: 100bp ladder.  Lane 1-2: Amplified product of E. coli  strain

(b) Lane M: 100bp ladder. Lane-1 to 2: Amplified product of K. pneumonia  

     strain

         (c) Lane M: 100bp ladder, Lane  1to 2 Amplified product of E. coli strain

              of Sewage water

         (d) Lane M: 100bp ladder, Lane  1 Amplified product of K. pneumonia strain

              of Sewage water

        (e)  Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain of  

               Ground water

        (f)  Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain     

              of Ground water

       (g)  Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain     

              of Hindon River

       (h)  Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain     

              of Hindon River

       (i)   Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain     

              of Faridabad waste water

       (j)   Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain     

              of Faridabad waste water

      (k)   Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain     

              of Canal water

      (l)    Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain     

              of Canal water

 

 

          An overview to distribution of virulence gene which cause antibiotic resistance Table 56 &  

          57.

 

Genes

Frequency

Percentage

TEM

46

65.21%

CTX-M

46

34.7 %

QnrS

46

30.43 %

Aac lb-cr

46

19 %

 

            Table 56:  Frequency and distribution of virulence gene in collected strains in E. coli

Genes

Frequency

Percentage

TEM

30

66.66 %

CTX-M

30

36.66 %

QnrS

30

19.56%

Aac lb-cr

30

23.33 %

 

             Table 57:  Frequency and distribution of virulence gene in collected strains in K.

                              Pneumonia.

 

  

Genes

Respective Genes of ESBL presence in E. coli

Respective genes of ESBL is not presence in E. coli

TEM

65.21%

34.79 %

CTX-M

34.7 %

65.3 %

QnrS

30.43 %

69.57 %

Aac lb-cr

19 %

81 %

             

                      Table  58 : Showing scoring of ESBL & PMQR genes in E. coli strains

 

Genes

Respective Genes of ESBL & PMQR  presence in K. pneumonia

Respective genes of ESBL & PMQR is not presence in K. pneumonia

TEM

66.66 %

33.44 %

CTX-M

36.66 %

63.33 %

QnrS

19.56 %

80.44 %

Aac lb-cr

23.33 %

76.67 %

                 

                     Table  59 : Showing scoring of ESBL & PMQR genes in K. pneumonia strains

            

4.7 DNA sequencing

            We have done DNA sequencing from 16Sr RNA, TEM, CTX-M and qnrS gene, we also

             considered the selected gene, like 16Sr RNA, ESBL & PMQR.

4.7.1 Sequences for 16Sr RNA gene:

 >16S-PUJA SAMPLE-1                        521

AGACATCCCATCGCACGGTATTCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACCCCACCTACGAGCTAAACCCATCTGGGCACATCCGATGGCAAGAA

>16S-PUJA SAMPLE-2                   365

GGGGGGGCTTTGGCACGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCAATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCTTGACCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCAGAAGGCCTTCTTCATACACACGACATGGATGCATCAAGCTTGCGGCCCATTG

>16S-PUJA SAMPLE-3                         685

AGGGGGCCTTGGCACGGTATTCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTAGCTAATCCCATCTGGGCACATCCGATGGCAAGAGGCCCGAAGGTCCCCCTCTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCACTCGTCAGCAAAGAAGCAAGCTTCTTCCTGTTACCGTTCGACTTGCATGTAAA

            >16S-PUJA SAMPLE-4                  689

AGCCTTGTCATCATATCGTACTATTCTACTTATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGTAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTAGCTAATCCCATCTGGGCACATCCGATGGCAAGAGGCCCGAAGGTCCCCCTCTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCACTCGTCAGCGAAACAGCAAGCTGCTTCCTGTTACCGTTCGCTTTTGGCATGTA

x

Hi!
I'm Barry!

Would you like to get a custom essay? How about receiving a customized one?

Check it out